View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_73 (Length: 386)
Name: NF19530_low_73
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_73 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 94 - 379
Target Start/End: Complemental strand, 34381319 - 34381034
Alignment:
| Q |
94 |
ttgtgaacatcacttacacaaataaacagataaattaagtccagtgttctacttctcttttgttttccacggtagagagggtttaccctagaaaacagaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381319 |
ttgtgaacatcacttacacaaataaacagataaattaagtccagtgttctacttctcttttgttttccacggtagagagggtttaccctagaaaacagaa |
34381220 |
T |
 |
| Q |
194 |
gaggggtcgtacatttgcctcgatcatctgcttaccttgttgtgctagtgattgttgtgacttcgcaactataaacttgattactcttccgaatcatata |
293 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381219 |
gaggagtcgtacatttgcctcgatcatctgcttaccttgttgtgctagtcattgttgtgacctcgcaactataaacttgattactcttccgaatcatata |
34381120 |
T |
 |
| Q |
294 |
tagaaattagataacaaagatttgaggatatctggcttatgatttataacattgctttaaggtttttcacttgaaggttcatatca |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34381119 |
tagaaattagataacaaagatttgaggatatctggcttatgatttacaacattgctttaaggtttttcacttgaaggttcacatca |
34381034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 34381371 - 34381296
Alignment:
| Q |
18 |
cgatgttgtaaattatcaaagttacttacctctaagttttgtgatctgtgttttgtgtacatcacttacacaaata |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34381371 |
cgatgttataaattatcaaagttacttacctctaagttttgtgatctgtgttttgtgaacatcacttacacaaata |
34381296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University