View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_77 (Length: 372)
Name: NF19530_low_77
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 188 - 267
Target Start/End: Original strand, 28467155 - 28467234
Alignment:
| Q |
188 |
tgcgacgttcacaagattttcttacagcttcatttcctaaagtgacattttcatcagcaaaagatgtattcaaagctata |
267 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
28467155 |
tgcgatgttcagaagattttccgacagcttcatttcctaaagtgacattttcatcagcaaaaggtgtattcaaaactata |
28467234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University