View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19530_low_77 (Length: 372)

Name: NF19530_low_77
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19530_low_77
NF19530_low_77
[»] chr2 (1 HSPs)
chr2 (188-267)||(28467155-28467234)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 188 - 267
Target Start/End: Original strand, 28467155 - 28467234
Alignment:
188 tgcgacgttcacaagattttcttacagcttcatttcctaaagtgacattttcatcagcaaaagatgtattcaaagctata 267  Q
    ||||| ||||| |||||||||  |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
28467155 tgcgatgttcagaagattttccgacagcttcatttcctaaagtgacattttcatcagcaaaaggtgtattcaaaactata 28467234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University