View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19530_low_94 (Length: 339)

Name: NF19530_low_94
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19530_low_94
NF19530_low_94
[»] chr4 (1 HSPs)
chr4 (21-327)||(34243018-34243324)


Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 21 - 327
Target Start/End: Original strand, 34243018 - 34243324
Alignment:
21 cctagagctaatacggacttggattgtccgcaatcagactaatatgcatcgtttatgttgaatcggacagctcatataatgtatatttcaatttcaaatt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
34243018 cctagagctaatacggacttggattgtccgcaatcagactaatatgcatcgtttatgttgaatcggacagctcatatcatgtatatttcaatttcaaatt 34243117  T
121 gatccttgccttcaaagtttaccaaggatcaggattgcaactgtggtcaaaagtgactgcaggcaatccataggctttgatctctcccttaatcttgtgg 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34243118 gatccttgccttcaaagtttaccaaggatcaggattgcaactgtggtcaaaagtgactgcaggcaatccataggctttgatctctcccttaatcttgtgg 34243217  T
221 tcaaggattcgatctcaggtaggggattatggaagaggatatagtgggaaaatagttctcattaccttgatcaatggttaatcatttgattcagcttata 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34243218 tcaaggattcgatctcaggtaggggattatggaagaggatatagtgggaaaatagttctcattaccttgatcaatggttaatcatttgattcagcttata 34243317  T
321 taatatt 327  Q
    |||||||    
34243318 taatatt 34243324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University