View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_94 (Length: 339)
Name: NF19530_low_94
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 21 - 327
Target Start/End: Original strand, 34243018 - 34243324
Alignment:
| Q |
21 |
cctagagctaatacggacttggattgtccgcaatcagactaatatgcatcgtttatgttgaatcggacagctcatataatgtatatttcaatttcaaatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34243018 |
cctagagctaatacggacttggattgtccgcaatcagactaatatgcatcgtttatgttgaatcggacagctcatatcatgtatatttcaatttcaaatt |
34243117 |
T |
|
| Q |
121 |
gatccttgccttcaaagtttaccaaggatcaggattgcaactgtggtcaaaagtgactgcaggcaatccataggctttgatctctcccttaatcttgtgg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34243118 |
gatccttgccttcaaagtttaccaaggatcaggattgcaactgtggtcaaaagtgactgcaggcaatccataggctttgatctctcccttaatcttgtgg |
34243217 |
T |
|
| Q |
221 |
tcaaggattcgatctcaggtaggggattatggaagaggatatagtgggaaaatagttctcattaccttgatcaatggttaatcatttgattcagcttata |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34243218 |
tcaaggattcgatctcaggtaggggattatggaagaggatatagtgggaaaatagttctcattaccttgatcaatggttaatcatttgattcagcttata |
34243317 |
T |
|
| Q |
321 |
taatatt |
327 |
Q |
| |
|
||||||| |
|
|
| T |
34243318 |
taatatt |
34243324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University