View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19530_low_95 (Length: 333)
Name: NF19530_low_95
Description: NF19530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19530_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 105 - 261
Target Start/End: Complemental strand, 16178223 - 16178067
Alignment:
| Q |
105 |
cttacccatattgtgatagacattttcgttctcaacaatgctttaggaggtcatcaaaaggctcaaacgcatgagcgtgaagcagagagaaacttttctt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16178223 |
cttacccatattgtgatagacattttcgttctcaacaatgctttaggaggtcatcaaaaggctcaaacgcatgagcgtgaagcagagagaaacttttctt |
16178124 |
T |
 |
| Q |
205 |
ggaagtcgaaaacttacttatgcaaatattatgacaaacaattttgttctccataag |
261 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16178123 |
ggaagtcgaaaacttactcgtgcaaatattatgacaaacagttttgttctccataag |
16178067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 16178327 - 16178273
Alignment:
| Q |
1 |
ttccaccaacaaagaaattggatgtgggttcatctcgctaagttgagctaataac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16178327 |
ttccaccaacaaagaaattggatgtgggttcatctcgctaagttgagctaataac |
16178273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University