View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19531_high_10 (Length: 305)
Name: NF19531_high_10
Description: NF19531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19531_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 10397612 - 10397876
Alignment:
| Q |
19 |
actactactatacagttgttacttgtcaataaccaggaaataaaatctaaacaacagacctcgcattctttttgctgaactttcatcgcattgaccgctc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397612 |
actactactatacagttgttacttgtcaataaccaggaaataaaatctaaacaacagacctcgcattctttttgctgaactttcatcgcattgaccgctc |
10397711 |
T |
 |
| Q |
119 |
ttgcattggcaaatctccattgcagataccgattataaaacattctaagtgaatgcacatcttcctgatgactagaccctttcttccctttcctcgtatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397712 |
ttgcattggcaaatctccattgcagataccgattataaaacattctaagtgaatgcacatcttcctgatgactagaccctttcttccctttcctcgtatc |
10397811 |
T |
 |
| Q |
219 |
caccacaggtttcgaaaattgcggagccaccggcggctttgtaacagaagcatgttgcctctctg |
283 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397812 |
caccacaggtttcgcaaattgcggagccaccggcggctttgtaacagaagcatgttgcctctctg |
10397876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University