View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19531_low_18 (Length: 213)

Name: NF19531_low_18
Description: NF19531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19531_low_18
NF19531_low_18
[»] chr3 (1 HSPs)
chr3 (27-196)||(34145172-34145329)


Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 27 - 196
Target Start/End: Complemental strand, 34145329 - 34145172
Alignment:
27 gaacctgtgcgtcatagcatagcatacagcctttctttctgtcataaaacgtgcaaaccaagaaaccaatctctgaactcacaactccaaacacaataaa 126  Q
    |||||| || ||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34145329 gaacctatgtgtcatagcatagcatacagcctttct----gtcataaaacgtgcaaaccaagaaaccaatctctgaactcacaactccaaacacaataaa 34145234  T
127 taaataaataaatatgtacgacatatcaacatttttatattcaacttgtgaagctatattgaacattctt 196  Q
    ||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34145233 ta--------aatatgtacgacatatcaacatttttatattcaacttgtgaagctatattgaacattctt 34145172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University