View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19531_low_18 (Length: 213)
Name: NF19531_low_18
Description: NF19531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19531_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 27 - 196
Target Start/End: Complemental strand, 34145329 - 34145172
Alignment:
| Q |
27 |
gaacctgtgcgtcatagcatagcatacagcctttctttctgtcataaaacgtgcaaaccaagaaaccaatctctgaactcacaactccaaacacaataaa |
126 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34145329 |
gaacctatgtgtcatagcatagcatacagcctttct----gtcataaaacgtgcaaaccaagaaaccaatctctgaactcacaactccaaacacaataaa |
34145234 |
T |
 |
| Q |
127 |
taaataaataaatatgtacgacatatcaacatttttatattcaacttgtgaagctatattgaacattctt |
196 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34145233 |
ta--------aatatgtacgacatatcaacatttttatattcaacttgtgaagctatattgaacattctt |
34145172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University