View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19534_high_15 (Length: 243)
Name: NF19534_high_15
Description: NF19534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19534_high_15 |
 | |
|
| [»] scaffold0025 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29801916 - 29801691
Alignment:
| Q |
1 |
tgaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29801916 |
tgaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgg |
29801817 |
T |
|
| Q |
101 |
gttcaccataggcatgttatagccccattattttctcctcttaacttgaaggttttctctttcccttactcactagagaaaatatattataaattgagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29801816 |
gttcaccataggcatgttatagccccattattttctcctcttaacttgaaggttttctctttcccttactcactagagaaaatatattataaattgagtt |
29801717 |
T |
|
| Q |
201 |
acaatttcaactttaaatcgtatatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29801716 |
acaatttcaactttaaatcgtatatc |
29801691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 68
Target Start/End: Complemental strand, 45412820 - 45412754
Alignment:
| Q |
2 |
gaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaa |
68 |
Q |
| |
|
||||| || ||||||||||||||||| |||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
45412820 |
gaagtgatggcaaagagatggggaaagccaagtgtttttagaaatgatagagatcccatgtttggaa |
45412754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 45422214 - 45422157
Alignment:
| Q |
11 |
gcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaa |
68 |
Q |
| |
|
|||||||||||||| || |||| ||| ||||||||||||||||| || |||||||||| |
|
|
| T |
45422214 |
gcaaagagatgggggaagccaagtgtttttagaaatgatagagaacctatgtttggaa |
45422157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 144
Target Start/End: Complemental strand, 66323 - 66193
Alignment:
| Q |
14 |
aagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgggttcaccataggc |
113 |
Q |
| |
|
|||| |||||||||||| | |||||||||||| || || || |||||||||||||| |||||||| ||||||||||||| | ||||| || ||| | | |
|
|
| T |
66323 |
aagacatggggaaaacctagtgtgtttagaaaagacagggatcccatgtttggaaatggtttggtcatggctgaaggcaacaagtgggtacatcatcgac |
66224 |
T |
|
| Q |
114 |
atgttatagccccattattttctcctcttaa |
144 |
Q |
| |
|
|| ||||||||||| ||||||||| ||||| |
|
|
| T |
66223 |
atattatagccccagcattttctccacttaa |
66193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 26837066 - 26836973
Alignment:
| Q |
11 |
gcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgggttc |
104 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| ||||| ||||||||||| || || ||||| |||| ||| |||| ||| ||||||| |
|
|
| T |
26837066 |
gcaaagagatggggaaaacctaatgtttttagaaatgacagagatcccatgtttgggaatggcttggtcatggttgagggcaatgattgggttc |
26836973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University