View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19534_high_15 (Length: 243)

Name: NF19534_high_15
Description: NF19534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19534_high_15
NF19534_high_15
[»] chr1 (3 HSPs)
chr1 (1-226)||(29801691-29801916)
chr1 (2-68)||(45412754-45412820)
chr1 (11-68)||(45422157-45422214)
[»] scaffold0025 (1 HSPs)
scaffold0025 (14-144)||(66193-66323)
[»] chr6 (1 HSPs)
chr6 (11-104)||(26836973-26837066)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29801916 - 29801691
Alignment:
1 tgaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29801916 tgaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgg 29801817  T
101 gttcaccataggcatgttatagccccattattttctcctcttaacttgaaggttttctctttcccttactcactagagaaaatatattataaattgagtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29801816 gttcaccataggcatgttatagccccattattttctcctcttaacttgaaggttttctctttcccttactcactagagaaaatatattataaattgagtt 29801717  T
201 acaatttcaactttaaatcgtatatc 226  Q
    ||||||||||||||||||||||||||    
29801716 acaatttcaactttaaatcgtatatc 29801691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 68
Target Start/End: Complemental strand, 45412820 - 45412754
Alignment:
2 gaagttattgcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaa 68  Q
    ||||| || ||||||||||||||||| |||| ||| ||||||||||||||||| |||||||||||||    
45412820 gaagtgatggcaaagagatggggaaagccaagtgtttttagaaatgatagagatcccatgtttggaa 45412754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 45422214 - 45422157
Alignment:
11 gcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaa 68  Q
    |||||||||||||| || |||| ||| ||||||||||||||||| || ||||||||||    
45422214 gcaaagagatgggggaagccaagtgtttttagaaatgatagagaacctatgtttggaa 45422157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0025
Description:

Target: scaffold0025; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 144
Target Start/End: Complemental strand, 66323 - 66193
Alignment:
14 aagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgggttcaccataggc 113  Q
    |||| |||||||||||| | |||||||||||| || || || |||||||||||||| |||||||| |||||||||||||   | ||||| || ||| | |    
66323 aagacatggggaaaacctagtgtgtttagaaaagacagggatcccatgtttggaaatggtttggtcatggctgaaggcaacaagtgggtacatcatcgac 66224  T
114 atgttatagccccattattttctcctcttaa 144  Q
    || |||||||||||  ||||||||| |||||    
66223 atattatagccccagcattttctccacttaa 66193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 26837066 - 26836973
Alignment:
11 gcaaagagatggggaaaaccaaatgtgtttagaaatgatagagagcccatgtttggaaaaggtttggttatggctgaaggcagtgaatgggttc 104  Q
    |||||||||||||||||||| ||||| ||||||||||| ||||| ||||||||||| || || ||||| |||| ||| |||| ||| |||||||    
26837066 gcaaagagatggggaaaacctaatgtttttagaaatgacagagatcccatgtttgggaatggcttggtcatggttgagggcaatgattgggttc 26836973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University