View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19534_high_17 (Length: 218)
Name: NF19534_high_17
Description: NF19534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19534_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 36571062 - 36571251
Alignment:
| Q |
17 |
aggtataaaacaggcactcttgtacgtaatttataaattgagtttttagtccaagatgaaaaacggtcaagatgaagataagtcctttttcctggtctca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571062 |
aggtataaaacaggcactcttgtacgtaatttataaattgagtttttagtccaagatgaaaaacggtcaagatgaagataagtcctttttcctggtctca |
36571161 |
T |
 |
| Q |
117 |
cgatctaaaatccagaactttaggctattcaaactttgagggatagtgatcgatcgatgcatgtgcatgaagaaatatttcattgatttt |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571162 |
cgatctaaaatccagaactttaggttattcaaactttgagggatagtgatcgatcgatgcatgtgcatgaagaaatatttcattgatttt |
36571251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University