View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19535_low_4 (Length: 250)
Name: NF19535_low_4
Description: NF19535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19535_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 30824423 - 30824185
Alignment:
| Q |
13 |
aatatgttgaaataaagagggaggagcgtgtaagatacgtaaaagaaagagaaggtggtagttcaagtgttgtgttaagagaaggttcactttccagttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30824423 |
aatatgttgaaataaagagggaggagcgtgtaagatacgtaaaagaaagagaaggtggttgttcaagtgttgtgttaagagaaggttcactttccagttg |
30824324 |
T |
 |
| Q |
113 |
tccaatgaaagcgatgaacgtaacaagcgaaatagcgacacgtgtgggaccgcatgtcaaaggagattgacgcttgcagaatatcttagattctcattat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30824323 |
tccaatgaaagcgatgaacgtaacaagcgaaatagcgacacgtgtgggaccgcatgtcaaaggagattgacgcttgcagaatatcttagattctcattat |
30824224 |
T |
 |
| Q |
213 |
tgcatttaagacgcgtggcattttt-gtacgtagttcga |
250 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30824223 |
tgcatttaagacgcgtggcatttttcgtacgtagttcga |
30824185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University