View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19536_high_25 (Length: 243)
Name: NF19536_high_25
Description: NF19536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19536_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 39988225 - 39988431
Alignment:
| Q |
19 |
ggtttaatacggtgtcgtttagtgatgaagtttgtgatgatgttagggctttattgagaaggtataaagaagggtggtcgatgacatcctccgatggtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39988225 |
ggtttaatacggtgtcgtttagtgatgaagtttgtgatgatgttagggctttattgagaaggtataaagaagggtggtcgatgacatcctccgatggtga |
39988324 |
T |
 |
| Q |
119 |
taccggaatattcttgtcgtggaaggataagccggtggtgtgggccagtgtatggaggccttgaggtggcgctgacgtggcatgggtgattcacacgtgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39988325 |
taccggaatattcttgtcgtggaaggataagccggtggtgtgggccagtgtatggaggccttgaggtggcgctgacgtggcatgggtgattcacacgtgc |
39988424 |
T |
 |
| Q |
219 |
tctaaat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
39988425 |
tctaaat |
39988431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 5365088 - 5364928
Alignment:
| Q |
19 |
ggtttaatacggtgtcgtttagtgatgaagtttgtgatgatgttagggctttattgagaaggtataaagaagggtggtcgatgacatcctccgatg--gt |
116 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||| | || || | |
|
|
| T |
5365088 |
ggtttaatacggtggcgtttagtgaggaagtttgtgatgatgttagggctttgttgaggaggtataaggaagggtggtcgatga-----tacggtgtaat |
5364994 |
T |
 |
| Q |
117 |
gataccggaatattcttgtcgtggaaggataagccggtggtgtgggccagtgtatggaggccttga |
182 |
Q |
| |
|
||| |||||||||||||| |||||||||| | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
5364993 |
gatgccggaatattcttgacgtggaaggaacaaccggtggtgtgggccagtgcatggaggccttga |
5364928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University