View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19536_low_27 (Length: 208)

Name: NF19536_low_27
Description: NF19536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19536_low_27
NF19536_low_27
[»] chr8 (3 HSPs)
chr8 (18-189)||(474841-475012)
chr8 (73-156)||(455584-455667)
chr8 (75-154)||(480245-480324)
[»] chr2 (1 HSPs)
chr2 (73-156)||(27491398-27491481)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 474841 - 475012
Alignment:
18 actaaatgcagaaaacatactacctacaaaatctatcatggccataacctccgttagtgatgagagttggttgcttggatgtgtgtatcttttggtaagt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||    
474841 actaaatgcagaaaacatactacctacaaaatctatcatggccataacctccggtagtgatgatagttggttgcttggatgtgtgtatcttttgggaagt 474940  T
118 agtgttgcctggtcactttggctcattttgcaggtatttatttatgtcgataagcatcgctagcttatatat 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
474941 agtgttgcctggtcactttggctcattttgcaggtatttatttatgtcgataagcatcgctagcttatatat 475012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 156
Target Start/End: Original strand, 455584 - 455667
Alignment:
73 agtgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtattt 156  Q
    |||||||||| ||||||| |||| ||| | | ||| |||| ||||||||||||| | ||| ||||||| |||||||||||||||    
455584 agtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt 455667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 154
Target Start/End: Original strand, 480245 - 480324
Alignment:
75 tgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtat 154  Q
    |||||||| |||||||||||||||| | | |||||| | ||   ||||||| |||||| |||||||||||||||||||||    
480245 tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat 480324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 73 - 156
Target Start/End: Complemental strand, 27491481 - 27491398
Alignment:
73 agtgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtattt 156  Q
    |||||||||| |||||||||||||||| ||  |||||| | |||  |||||||||||||| ||||||| |||||||||||||||    
27491481 agtgatgagaattggttgcttggatgtttggttctttttggaagctgtgttgcctggtcagtttggcttattttgcaggtattt 27491398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University