View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19536_low_27 (Length: 208)
Name: NF19536_low_27
Description: NF19536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19536_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 474841 - 475012
Alignment:
| Q |
18 |
actaaatgcagaaaacatactacctacaaaatctatcatggccataacctccgttagtgatgagagttggttgcttggatgtgtgtatcttttggtaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
474841 |
actaaatgcagaaaacatactacctacaaaatctatcatggccataacctccggtagtgatgatagttggttgcttggatgtgtgtatcttttgggaagt |
474940 |
T |
 |
| Q |
118 |
agtgttgcctggtcactttggctcattttgcaggtatttatttatgtcgataagcatcgctagcttatatat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474941 |
agtgttgcctggtcactttggctcattttgcaggtatttatttatgtcgataagcatcgctagcttatatat |
475012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 156
Target Start/End: Original strand, 455584 - 455667
Alignment:
| Q |
73 |
agtgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtattt |
156 |
Q |
| |
|
|||||||||| ||||||| |||| ||| | | ||| |||| ||||||||||||| | ||| ||||||| ||||||||||||||| |
|
|
| T |
455584 |
agtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt |
455667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 154
Target Start/End: Original strand, 480245 - 480324
Alignment:
| Q |
75 |
tgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtat |
154 |
Q |
| |
|
|||||||| |||||||||||||||| | | |||||| | || ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
480245 |
tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
480324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 73 - 156
Target Start/End: Complemental strand, 27491481 - 27491398
Alignment:
| Q |
73 |
agtgatgagagttggttgcttggatgtgtgtatcttttggtaagtagtgttgcctggtcactttggctcattttgcaggtattt |
156 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||| | ||| |||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
27491481 |
agtgatgagaattggttgcttggatgtttggttctttttggaagctgtgttgcctggtcagtttggcttattttgcaggtattt |
27491398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University