View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19537_low_5 (Length: 249)
Name: NF19537_low_5
Description: NF19537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19537_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 34390550 - 34390455
Alignment:
| Q |
1 |
ttgaatgtgttttttctcttaggtttatcactagatgggccttcacttataaagcatataaaattgagcaagttttatttcaggaagagtcttaag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34390550 |
ttgaatgtgttttttctcttaggtttatcactagatgggccttcacttataaagtatataaaattgagcaagttttatttcaggaagagtcttaag |
34390455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 149 - 233
Target Start/End: Complemental strand, 34390403 - 34390319
Alignment:
| Q |
149 |
ggtttggtcacattaatcaaaagaaggatcgataacaagatgaaatcttgaaactcagatgaaatattcaaatcacccttccttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34390403 |
ggtttggtcacattaatcaaaagaaggatcgataacaagatgaaatcttgaaactcagatgaaatattcaaatcacccttccttt |
34390319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University