View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_high_14 (Length: 394)
Name: NF19539_high_14
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_high_14 |
 |  |
|
| [»] scaffold0201 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 28498543 - 28498454
Alignment:
| Q |
1 |
aataacaaaagtatgatcgaaaattatcataataattgtcctaaaatgatagttttaatatcatctctaaacatttttgtttaatctata |
90 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28498543 |
aataacaaaagtatgatcgaacattatcataaaaattgtcctaaaatgataattttaatatcatctctaaacatttttgtttaatctata |
28498454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 29810954 - 29810865
Alignment:
| Q |
1 |
aataacaaaagtatgatcgaaaattatcataataattgtcctaaaatgatagttttaatatcatctctaaacatttttgtttaatctata |
90 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29810954 |
aataacaaaagtatgatcgaacattatcataaaaattgtcctaaaatgataattttaatatcatctctaaacatttttgtttaatctata |
29810865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 126 - 298
Target Start/End: Complemental strand, 29697846 - 29697681
Alignment:
| Q |
126 |
tactgacacaagcacgtcccagcattttaacatttctgcttaatcaata---tactgacaagcatgt--cccactttcttgactttagatactccaaaag |
220 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||| ||||||| |||||||||| ||| ||||| ||||||||||||||||||||||| | |
|
|
| T |
29697846 |
tactgacacaagcgcgtcccaacagtttaacatttctgcttgatcaataatatactgacaagtgtgtgtcccaccttcttgactttagatactccaaa-g |
29697748 |
T |
 |
| Q |
221 |
tctttcttaagttcagcagtacagtcattcactcatcctagctcaattttatccaaacaactgttctttcatttgaat |
298 |
Q |
| |
|
||||| | ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29697747 |
tctttttgaagttcacta-----------cactcatcctagctcaattttatccaaacaactgttctttcatttgaat |
29697681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 323 - 372
Target Start/End: Complemental strand, 29733360 - 29733311
Alignment:
| Q |
323 |
caaatcaattcaagtatgatgtttttctcagctttcgaggtgaggatact |
372 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29733360 |
caaatcgattcaagtatgatgtttttctcagctttcgaggtgaggatact |
29733311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 323 - 372
Target Start/End: Complemental strand, 29697639 - 29697590
Alignment:
| Q |
323 |
caaatcaattcaagtatgatgtttttctcagctttcgaggtgaggatact |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
29697639 |
caaatcaattcaagtatgatgtttttctcagttttagaggcgaggatact |
29697590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 253 - 304
Target Start/End: Complemental strand, 29733465 - 29733414
Alignment:
| Q |
253 |
tcatcctagctcaattttatccaaacaactgttctttcatttgaatctgaat |
304 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
29733465 |
tcatcctagctcaattttctataaacaactgttctttcctttgaatctgaat |
29733414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 28481400 - 28481358
Alignment:
| Q |
330 |
attcaagtatgatgtttttctcagctttcgaggtgaggatact |
372 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
28481400 |
attcaagtacgatgttttcctcagctttcgaggtgaggatact |
28481358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 29793823 - 29793781
Alignment:
| Q |
330 |
attcaagtatgatgtttttctcagctttcgaggtgaggatact |
372 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29793823 |
attcaagtacgatgttttcctcagctttcgaggtgaggatact |
29793781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 28481754 - 28481710
Alignment:
| Q |
174 |
atactgacaagcatgtcccactttcttgactttagatactccaaa |
218 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
28481754 |
atactgacaagcgtgtcccactttcatgactttagatacttcaaa |
28481710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 29794177 - 29794133
Alignment:
| Q |
174 |
atactgacaagcatgtcccactttcttgactttagatactccaaa |
218 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
29794177 |
atactgacaagcgtgtcccactttcatgactttagatacttcaaa |
29794133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 12588324 - 12588370
Alignment:
| Q |
326 |
atcaattcaagtatgatgtttttctcagctttcgaggtgaggatact |
372 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12588324 |
atcaattcaagtacgatgtttttctcagctttcgaggtgaggatact |
12588370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0201 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0201
Description:
Target: scaffold0201; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 337 - 370
Target Start/End: Complemental strand, 13776 - 13743
Alignment:
| Q |
337 |
tatgatgtttttctcagctttcgaggtgaggata |
370 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
13776 |
tatgatgtttttcttagctttcgaggtgaggata |
13743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University