View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_high_16 (Length: 378)
Name: NF19539_high_16
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 37362363 - 37362184
Alignment:
| Q |
20 |
ctgtcaccgtttgaacatgaggttgagaaagggagtgatttcgcacttggacttcttgatgttaaggtaacttcacttccaccttttctctattccatca |
119 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37362363 |
ctgttaccgtttgaacatgaggttgagaaagggagcgctttcgcacttggacttcttgatgttaaggtaacttcacttccaccttttctctattccatca |
37362264 |
T |
|
| Q |
120 |
ttgttcatatttgtttattttatgaattttctctcaaggttatcgttttatctagattctaattgttatcatcctctctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37362263 |
ttgttcatatttgtttattttatgaattttctctcaaggttatcgttttatctagattctaattgttatcatcctctctc |
37362184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 684256 - 684184
Alignment:
| Q |
26 |
ccgtttgaacatgaggttgagaaagggagtgatttcgcacttggacttcttgatgttaaggtaacttcacttc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
684256 |
ccgtttgaacatgaggttgagaaagggagtgctttcgcgcttggacttcttgctgtcaaggtaatttcacttc |
684184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 7135542 - 7135603
Alignment:
| Q |
107 |
ctctattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgtttt |
168 |
Q |
| |
|
|||||||||||| ||||||| ||||||| ||||| |||||||||||||||||| || ||||| |
|
|
| T |
7135542 |
ctctattccatcgttgttcagatttgttgattttgtgaattttctctcaaggtaatagtttt |
7135603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 17831490 - 17831549
Alignment:
| Q |
110 |
tattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgtttta |
169 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||| |||||||||||||||||| || |||||| |
|
|
| T |
17831490 |
tattccatcgttgttcagatttgttgattttgtgaattttctctcaaggtaatagtttta |
17831549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University