View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_high_24 (Length: 297)
Name: NF19539_high_24
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 37111930 - 37111668
Alignment:
| Q |
15 |
cataggcaacgccgcagtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaac |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111930 |
cataggcaacgccgcggtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaac |
37111831 |
T |
|
| Q |
115 |
cctgactatggccatcttgaccctattgctattgcagctctagtagccataacagcccttgcagtttacagcaccaaaggctcttccatcttcaactaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111830 |
cctgactatggccatcttgaccctattgctattgcagctctagtagccatcacagcccttgcagtttacagcaccaaaggctcttccatcttcaactaca |
37111731 |
T |
|
| Q |
215 |
tagccacactcttacacatggctgtcattatcttcatagttatcgccggtctaatcaaagcca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111730 |
tagccacactcttacacatggctgtcattatcttcatagttatcgccggtctaatcaaagcca |
37111668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 37120181 - 37119923
Alignment:
| Q |
19 |
ggcaacgccgcagtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaaccctg |
118 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37120181 |
ggcaacgcggcggtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaatcctg |
37120082 |
T |
|
| Q |
119 |
actatggccatcttgaccctattgctattgcagctctagtagccataacagcccttgcagtttacagcaccaaaggctcttccatcttcaactacatagc |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||| ||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37120081 |
attatggccatcttgaccctattgctattggagccctagtagccatcacagctcttgcagtttacagcaccaaaggttcttccatcttcaactacatagc |
37119982 |
T |
|
| Q |
219 |
cacactcttacacatggctgtcattatcttcatagttatcgccggtctaatcaaagcca |
277 |
Q |
| |
|
|||| | || |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37119981 |
cacaatgttccacatggctgtcattatcttcatagtaatcgccggtctaatcaaagcca |
37119923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 31 - 144
Target Start/End: Original strand, 37136084 - 37136197
Alignment:
| Q |
31 |
gtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaaccctgactatggccatc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
37136084 |
gtagctcgatcatggacctcctattttgccaccctctgcaacaaaaatcctaacgattttcgtataatattccacaatatgaaccctgattatggtcatc |
37136183 |
T |
|
| Q |
131 |
ttgaccctattgct |
144 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37136184 |
ttgaccctattgct |
37136197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University