View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_low_28 (Length: 274)
Name: NF19539_low_28
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 45634417 - 45634337
Alignment:
| Q |
1 |
atctaatatattgaatgattattggttatggagatttttctcatgttgatgaagtcctagcataagtgaattgggtgatag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45634417 |
atctaatatattgaatgattattggttatggagatttttctcatgttgataaagtcctagcataagtgaattgggtgatag |
45634337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 182 - 258
Target Start/End: Complemental strand, 45634268 - 45634192
Alignment:
| Q |
182 |
tatctattaatttgatttcttgttttatccatatgcaggtttttgttgtaataaactagtattctaggaaatctttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45634268 |
tatctattaatttgatttcttgttttatcgatatgcaggttgttgttgtaataaactagtattctaggaaatctttg |
45634192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 45634315 - 45634267
Alignment:
| Q |
102 |
catttatttaacctattaaatctttggtaaaatacctaaatcagttata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45634315 |
catttatttaacctattaaatctttggtaaaatatctaaatcagttata |
45634267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University