View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_low_32 (Length: 237)
Name: NF19539_low_32
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 9693026 - 9692812
Alignment:
| Q |
1 |
atatttctatataattgatccttccatgagcaattggatgctttgtaagctcaatagctgatctattgctcaccaataatctcatcttcttatctttatt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9693026 |
atatttctatatatttgatccttccatgagcaattggatgctttgcaagctcaatagctgatctattgctcaccaataatctcatcttcttatctttatt |
9692927 |
T |
 |
| Q |
101 |
caaattcatctcttgcatcgacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaggagtataaagctataacatattcct |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| || |
|
|
| T |
9692926 |
caaattcatctcttgcatcaacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaagagtataaagctataacacatttct |
9692827 |
T |
 |
| Q |
201 |
tatttgagcaccatg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9692826 |
tatttgagcaccatg |
9692812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University