View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19539_low_33 (Length: 237)

Name: NF19539_low_33
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19539_low_33
NF19539_low_33
[»] chr8 (2 HSPs)
chr8 (1-90)||(32401511-32401600)
chr8 (189-223)||(32401382-32401416)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 32401600 - 32401511
Alignment:
1 cagtccaaagagttttgggctgatttttctacccctccaatctacaaaattaatcactctctcaagaactaaacaatatagttttaagta 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32401600 cagtccaaagagttttgggctgatttttctacccctccaatctacaaaattaatcactctctcaagaactaaacaatatagttttaagta 32401511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Complemental strand, 32401416 - 32401382
Alignment:
189 caagttattaattatttgatggaagaaagaatatg 223  Q
    |||||||||||||||||||||||||||||||||||    
32401416 caagttattaattatttgatggaagaaagaatatg 32401382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University