View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19539_low_35 (Length: 229)
Name: NF19539_low_35
Description: NF19539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19539_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 10928378 - 10928575
Alignment:
| Q |
18 |
aaatttgagatcttttttcgatggcagtgtggtgtggatgcaagtgcgacagaccgggtgcttttacagtcacttaagccttctcttcacacaaatgtgg |
117 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10928378 |
aaatttgagttcttttttcaatgacagtgtggtgtggatgcaagtgcgacggaccgggtgcttttacagtcacttaagccttctctccacacaaatgtgg |
10928477 |
T |
 |
| Q |
118 |
attgtaatgcactagttgcagctgtagttcataggcaggtccatgttgtcagtttgctccttcaggtaaacttttctcttaaccgcttcaaacctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10928478 |
attgtaatgcactagttgcagctgtagttcataggcaggtccatgttgtcagtttgctccttcaggtaaacttttctcttaaccgcttcaaacttttg |
10928575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University