View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19542_high_3 (Length: 421)
Name: NF19542_high_3
Description: NF19542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19542_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 34843621 - 34843895
Alignment:
| Q |
19 |
aaattagcctaatgaaatttcaatctaatatacttgtaagtttgtggtcacaacacgaacttttttcatagataagactatcnnnnnnnctttattaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34843621 |
aaattagcctaatgaaatttcaatctaatatacttgtaagtttgtggtcacaacacgaacttttttcatagataagactatctttttttctttattaatc |
34843720 |
T |
|
| Q |
119 |
ttagattcttgacaagaacggatgccttttgcgctaccgggtgttggcatttaacacatttgatctcaaaaactaaatgtttcctgtgcttttcgcaaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34843721 |
ttagattcttgacaagaacggatgccttttgcgctaccgggtgttggcatttaacacatttgatctcaaaaactaaatgtttcttgtgcttttcgcaaga |
34843820 |
T |
|
| Q |
219 |
gatgttcccaacattgctggtggatcccctttttctcgagccgtcacaaaaaccttagttttcttctccttcatc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34843821 |
gatgttcccaacattgctggtggatcccctttctctcgagccgtcaccaaaaccttagttttcttctccttcatc |
34843895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University