View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19543_high_17 (Length: 229)

Name: NF19543_high_17
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19543_high_17
NF19543_high_17
[»] chr4 (1 HSPs)
chr4 (28-212)||(4387538-4387722)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 28 - 212
Target Start/End: Original strand, 4387538 - 4387722
Alignment:
28 gactaatttggtaaaattgnnnnnnnctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc 127  Q
    |||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4387538 gactaatttggtaaaattgtttttttctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc 4387637  T
128 aaaatttcgcccttaattttggaaccttatgcttttcaataggggtttattagtgtcaattttggatttaagtttataagtttat 212  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
4387638 aaaatttcgcccttaattttggaaccttatgctattcaataggggtttattagtgtcaattttggatttaagtttataagtttat 4387722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University