View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19543_high_19 (Length: 217)
Name: NF19543_high_19
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19543_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 22 - 198
Target Start/End: Original strand, 39276674 - 39276850
Alignment:
| Q |
22 |
tatgagagggtggcttctatcattgctatggaaaaagagaatttaagtttggcaaggccacctgaatgatcttggcacgatatatttagcaaactttgtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276674 |
tatgagagggtggcttctatcattgctatggaaaaagagaatttaagtttggcaaggccacctgaatgatcttggcacgatatatttagcaaactttgtc |
39276773 |
T |
 |
| Q |
122 |
ttcaactgaaagatattagctgatattggaacttgtctccctaacagccaacaagcctaagagtaagatgatatatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276774 |
ttcaactgaaagatattagctgatattggaacttgtctccctaacagccaacaagcctaagagtaagatgatatatt |
39276850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University