View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19543_low_15 (Length: 251)
Name: NF19543_low_15
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19543_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 42493991 - 42493768
Alignment:
| Q |
18 |
attgcagtaacctaatttaacatgatatggtgaagaagtttcatagatattatacaacttcaacttcaaggaagaatcacgaggagttgaagaaggtttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42493991 |
attgcagtaacctaatttaacatgatatggtgaagaagtttcatagatattatacaacttcaacttcaaggaaggatcacgaggagttgaagaaggtttc |
42493892 |
T |
 |
| Q |
118 |
atacctagccagctgaccactttcttcaagcaactcagtagtatatttgcactgatcatcaagaatttaactctctgattaagcaattttgaccccgaca |
217 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42493891 |
atgcctagctagctgaccactttcttcaagcaactcaatagtatatttgcactgatcatcaataatttaactctctgattaagcaattttgaccccgaca |
42493792 |
T |
 |
| Q |
218 |
taatggagtgtgcctaaacctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42493791 |
taatggagtgtgcctaaacctatg |
42493768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 106 - 241
Target Start/End: Complemental strand, 42496084 - 42495950
Alignment:
| Q |
106 |
gaagaaggtttcatacctagccagctgacc-actttcttcaagcaactcagtag----tatatttgcactgatcatcaagaatttaactctctgattaag |
200 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||||||| ||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
42496084 |
gaagaaggtttcatgtctagctagctgacccactttcttcaagcaactcaatagtatatatatttgccgtgaatatcaagaatttaactc------taag |
42495991 |
T |
 |
| Q |
201 |
caattttgaccccgacataatggagtgtgcctaaacctatg |
241 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
42495990 |
caatttagaccccgacataatttagtgtgcctaaacctatg |
42495950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University