View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19543_low_17 (Length: 229)
Name: NF19543_low_17
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19543_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 28 - 212
Target Start/End: Original strand, 4387538 - 4387722
Alignment:
| Q |
28 |
gactaatttggtaaaattgnnnnnnnctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc |
127 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387538 |
gactaatttggtaaaattgtttttttctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc |
4387637 |
T |
 |
| Q |
128 |
aaaatttcgcccttaattttggaaccttatgcttttcaataggggtttattagtgtcaattttggatttaagtttataagtttat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387638 |
aaaatttcgcccttaattttggaaccttatgctattcaataggggtttattagtgtcaattttggatttaagtttataagtttat |
4387722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University