View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19543_low_18 (Length: 224)
Name: NF19543_low_18
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19543_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 9500191 - 9500357
Alignment:
| Q |
20 |
tgtacttggtagacctgtcgtattgatttaacattatgccttcaattttgtttcttcaatttttgagcatttatatgcatgtattataagttactcgagt |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500191 |
tgtacttggtagccctgtcgtattgatttaacattacgccttcaaatttttttcttcaatttttgagcatttatatgcatgtattataagttactcgagt |
9500290 |
T |
 |
| Q |
120 |
tgtctgcataagcttcagttgacatatcaattatcaaaaatatattttatgatttgtgtatgaaacaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9500291 |
tgtctgcataagcttcagttgacatatcaattatc-aaaatatattttatgatttgtgtatgtaacaa |
9500357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University