View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19543_low_19 (Length: 217)

Name: NF19543_low_19
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19543_low_19
NF19543_low_19
[»] chr2 (1 HSPs)
chr2 (22-198)||(39276674-39276850)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 22 - 198
Target Start/End: Original strand, 39276674 - 39276850
Alignment:
22 tatgagagggtggcttctatcattgctatggaaaaagagaatttaagtttggcaaggccacctgaatgatcttggcacgatatatttagcaaactttgtc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39276674 tatgagagggtggcttctatcattgctatggaaaaagagaatttaagtttggcaaggccacctgaatgatcttggcacgatatatttagcaaactttgtc 39276773  T
122 ttcaactgaaagatattagctgatattggaacttgtctccctaacagccaacaagcctaagagtaagatgatatatt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39276774 ttcaactgaaagatattagctgatattggaacttgtctccctaacagccaacaagcctaagagtaagatgatatatt 39276850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University