View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19543_low_6 (Length: 627)
Name: NF19543_low_6
Description: NF19543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19543_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 9e-44; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 372 - 462
Target Start/End: Original strand, 9113787 - 9113877
Alignment:
| Q |
372 |
gacctcgtggtaacttaaatttttctttccaccaagccaagaaagaaaccttataaacttaaaatgtcacatatatataaacaacaatact |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9113787 |
gacctcgtggtaacttaaatttttctttccaccaagccaagaaagaaaccttataaacttaaaatgtcacatatatataaacaacaatact |
9113877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 535 - 609
Target Start/End: Original strand, 9113940 - 9114014
Alignment:
| Q |
535 |
tatgccaaattttaatggtaacaataaccatggtaacactatctgcatccaatgaatccttttcttcatccttac |
609 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9113940 |
tatgccaaattttaatggtaacaataaccatggtaacactatctgcatccaatgaatccttttcttcatccttac |
9114014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 9113749 - 9113786
Alignment:
| Q |
1 |
cgtggaaaaagaaattacatagtattaattaaatattt |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9113749 |
cgtggaaaaagaaattacatagtattaattaaatattt |
9113786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 542 - 609
Target Start/End: Complemental strand, 9220956 - 9220886
Alignment:
| Q |
542 |
aattttaatggtaacaataaccatggtaacacta---tctgcatccaatgaatccttttcttcatccttac |
609 |
Q |
| |
|
||||||| | || |||||| ||||||||||| || | |||||||||||||||| ||||||||||||||| |
|
|
| T |
9220956 |
aattttagtagttacaatatccatggtaacaatagtatttgcatccaatgaatccctttcttcatccttac |
9220886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University