View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19545_high_24 (Length: 228)

Name: NF19545_high_24
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19545_high_24
NF19545_high_24
[»] chr4 (1 HSPs)
chr4 (1-209)||(31443722-31443930)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 31443722 - 31443930
Alignment:
1 gaaggtagagtgactgaatgaagcattttggttgttgagttcttagtgtgagccagaggaagaggatggtgaggcctgtgctggtgatgaagcttgtgca 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31443722 gaaggtagagtgattgaatgaagcattttggttgttgagttcttagtgtgagccagaggaagaggatggtgaggcctgtgctggtgatgaagcttgtgca 31443821  T
101 gcaggtgcagcagttgatgcggggttcccgcgcgggccgcgccatctatggtggttggttagttagtggtgatagaggatgaatgatgaagaagaataat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||    
31443822 gcaggtgcagcagttgatgcggggttcccgcgcgggccgcgccatctacggtggttggtttgttagtggtgatagaggatgaatgatgaagaagaataat 31443921  T
201 aacaagaag 209  Q
    |||||||||    
31443922 aacaagaag 31443930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University