View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19545_high_30 (Length: 213)
Name: NF19545_high_30
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19545_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 128
Target Start/End: Original strand, 45666117 - 45666240
Alignment:
| Q |
9 |
gataatactaataaaacttgaaagaagcccgcccggtgccacnnnnnnnctttgccttatatatcttt-----gtacctctttccttaatcacctcctaa |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
45666117 |
gataataataataaaacttgaaagaagcccgcccggtgccactttttttctttgccttatatatctttactttgtacctctt-ccttaatcacctcctaa |
45666215 |
T |
 |
| Q |
104 |
atttcctttgttcacgttaatatag |
128 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
45666216 |
atttcctttgttcacattaatatag |
45666240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University