View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19545_low_18 (Length: 337)
Name: NF19545_low_18
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19545_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 32860941 - 32860616
Alignment:
| Q |
1 |
tttactttggtgttgcattgcaggggatgtgattattagccaagagccctatgtttgtgttccaactcaaaaaaggtgtgatggatgtttctcaacaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860941 |
tttactttggtgttgcattgcaggggatgtgattattagccaagagccctatgtttgtgttccaactcaaaaaaggtgtgatggatgtttctcaacaact |
32860842 |
T |
|
| Q |
101 |
aaccttagcaaatgctcacgttgtcaagttgtttggtattgcggaacaccatgtcaggttttgtatcctttcttatcataagtgttgtcggcttcgtccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860841 |
aaccttagcaaatgctcacgttgtcaagttgtttggtattgcggaacaccatgtcaggttttgtatcctttcttatcataagtgttgtcggcttcgtccg |
32860742 |
T |
|
| Q |
201 |
acatgtgtcattgctacagggaatgtaacaatgatagaagcacaatgagtgttggtttacataacacagtatagattgtggaaaaataaaattgatatgg |
300 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860741 |
acatgtgtcattgttgcagggaatgtaacaatgatagaagcacaatgagtgttggtttacataacacagtatagattgtggaaaaataaaattgatatgg |
32860642 |
T |
|
| Q |
301 |
tgtgttattgtggttcttttgatgat |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32860641 |
tgtgttattgtggttcttttgatgat |
32860616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University