View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19545_low_30 (Length: 223)
Name: NF19545_low_30
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19545_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 52 - 206
Target Start/End: Original strand, 32861017 - 32861171
Alignment:
| Q |
52 |
tgacctgggtggaaatctctagtagtaaaaagagaacgacccttttctgagatggtggaaactgttaaattacaattcttcagtgcttgttgcaattcct |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861017 |
tgacctgggtggaaatctctagtagtaaaaagagaacgacccttttctgagatggtggaaactgttaaattacaattcttcagtgcttgttgcaattcct |
32861116 |
T |
|
| Q |
152 |
ccatttccgtcttcacttcactcgtttatcggtatctccactttatttatatttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861117 |
ccatttccgtcttcacttcactcgtttatcggtatctccactttatttatatttt |
32861171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 32860962 - 32860996
Alignment:
| Q |
3 |
atcattcattctattcgttttcattcaaactagtt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860962 |
atcattcattctattcgttttcattcaaactagtt |
32860996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University