View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19545_low_31 (Length: 221)
Name: NF19545_low_31
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19545_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 41282231 - 41282045
Alignment:
| Q |
16 |
gcataggataagtttggtctcaaattggtttagctaggattatttgttaaggatcacgtgagattttacccttcatttgattggccatagattacatact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41282231 |
gcataggataagtttggtctcaaattggtttagctaggattatttgttaaggatcacgtgagattttactcttcatttgattggccatagattacatact |
41282132 |
T |
 |
| Q |
116 |
gattgagatgcagggcttctggtgtgagcgtgacaccaatcttcataatatttttgcgaccttagcagctggacataaaatagtcag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282131 |
gattgagatgcagggcttctggtgtgagtgtgacaccaatcttcataatatttttgcgaccttagcagctggacataaaatagtcag |
41282045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University