View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19545_low_33 (Length: 217)
Name: NF19545_low_33
Description: NF19545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19545_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 6349483 - 6349668
Alignment:
| Q |
18 |
atgacattgtcacattgacttatggttttccagtcctctaataatactcttaactttggtggcatatttgttgagtttctttgacttccccttttgggaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6349483 |
atgacattgtcacattgacttatggctttccagtcctctaataatactcttaactttggtggcatatttgttgtgtttctttgacttccccttttgggaa |
6349582 |
T |
|
| Q |
118 |
atgtcaattggtttgctaaccaatctttggtcatcaacccgtgttggtttgttatagttcattctataatgtctaacatattcatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6349583 |
atgtcaattggtttgctaaccaatctttggtcatcaacccgtgttggtttgttatagttcattctataatgtctaacatattcatc |
6349668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University