View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19547_high_14 (Length: 247)
Name: NF19547_high_14
Description: NF19547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19547_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 20 - 156
Target Start/End: Original strand, 38554525 - 38554661
Alignment:
| Q |
20 |
acagtactaacgaggggagcaatgcgcgaatgtggacaatgatcatgatgaacggtgttcgtgatgcgaacaacgctgatgtgaacaatacttttgatga |
119 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
38554525 |
acagtactaacgaggtgaacaatgcgcgaatgtggacaatgatcatgatgaacggtgttcgtgatgcaaacaatgctgatgtgaacaatactttcgatga |
38554624 |
T |
 |
| Q |
120 |
at--tgcatcgacaaatgaacaaattgcttgttggatct |
156 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
38554625 |
atagtgcatcgacaaatgaacaaa--gcttgttggatct |
38554661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University