View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19547_low_14 (Length: 247)

Name: NF19547_low_14
Description: NF19547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19547_low_14
NF19547_low_14
[»] chr5 (1 HSPs)
chr5 (20-156)||(38554525-38554661)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 20 - 156
Target Start/End: Original strand, 38554525 - 38554661
Alignment:
20 acagtactaacgaggggagcaatgcgcgaatgtggacaatgatcatgatgaacggtgttcgtgatgcgaacaacgctgatgtgaacaatacttttgatga 119  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||    
38554525 acagtactaacgaggtgaacaatgcgcgaatgtggacaatgatcatgatgaacggtgttcgtgatgcaaacaatgctgatgtgaacaatactttcgatga 38554624  T
120 at--tgcatcgacaaatgaacaaattgcttgttggatct 156  Q
    ||  ||||||||||||||||||||  |||||||||||||    
38554625 atagtgcatcgacaaatgaacaaa--gcttgttggatct 38554661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University