View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19548_high_12 (Length: 268)

Name: NF19548_high_12
Description: NF19548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19548_high_12
NF19548_high_12
[»] chr3 (1 HSPs)
chr3 (13-249)||(40184268-40184504)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 40184268 - 40184504
Alignment:
13 gtgagatgaacgggttgagatggtgagtattaggtgagacgaaacgagttaactccttgaactcgttgttaaccaggtcgaataattcaatgtgacggaa 112  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40184268 gtgagataaacgggttgagatggtgagtattaggtgagacgaaacgagttaactccttgaactcgttgttaaccaggtcgaataattcaatgtgacggaa 40184367  T
113 gttagagccaggtcttctcgttgcgacggcgatgaatttgttgtttcccggtgaagttgccggtgtgaatacgtgtaaacccggtggggtaactcgttcg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40184368 gttagagccaggtcttctcgttgcgacggcgatgaatttgttgtttcccggtgaagttgccggtgtgaatacgtgtaaacccggtggggtaactcgttcg 40184467  T
213 atgagaacagagtaagaagaatcagtggtgagaattg 249  Q
    |||||||||||||||||||||||||||||||||||||    
40184468 atgagaacagagtaagaagaatcagtggtgagaattg 40184504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University