View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19548_high_14 (Length: 249)
Name: NF19548_high_14
Description: NF19548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19548_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 41777209 - 41776996
Alignment:
| Q |
14 |
agtagcatagggaatggggaacctcttgagcaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777209 |
agtaccatagggaatggggaacctcttgagtaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacc |
41777110 |
T |
 |
| Q |
114 |
tgcaatcaaaatccttgtaagttaaattgcttaagtttttagcttaaaatcaaactgtgtcatgcatgtgaagggatttgggaaacagatttgggttgtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777109 |
tgcaatcaaaatccttgtaagttaaattgcttaagtttttagcttaaaatcaaactgtgtcatgcatgtgaagggatttgggaaacagatttgggttgtg |
41777010 |
T |
 |
| Q |
214 |
tgtaggcataatct |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41777009 |
tgtaggcataatct |
41776996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 26956953 - 26957042
Alignment:
| Q |
30 |
gggaacctcttgagcaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacctgcaat |
119 |
Q |
| |
|
|||||||||||||| | |||||| |||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26956953 |
gggaacctcttgagaatgtagaactcaaaaacagacaaagatgatgaaaacatcatcacaaatgttgctgttgcactagcaacctacaat |
26957042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University