View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19548_high_15 (Length: 239)
Name: NF19548_high_15
Description: NF19548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19548_high_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 28477024 - 28476803
Alignment:
| Q |
18 |
ggtaaaagggtccgaaccgagaccaacattgctgctggtgcagtttctgttagctcagctgcagtcgaattagccttgatgaagttacctgatcaagcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28477024 |
ggtaaaagggtccgaaccgagaccaacattgcagctggtgcagtttctgttagctcggctgcagtcgaattagccttgatgaagttacctgatcaagcct |
28476925 |
T |
|
| Q |
118 |
cacatggaaatgcaagaatgcttgttattggagctggtaaaatggggaagcttgtgatcaaacatttggttgcaaaagggtgtaaaaagatggtagttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28476924 |
cacatggaaatgcaagaatgcttgttattggagctggtaaaatggggaagcttgtgatcaaacatttggttgcaaaagggtgtaaaaagatggtagttgt |
28476825 |
T |
|
| Q |
218 |
taatagaaccgaagggagagtc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28476824 |
taatagaaccgaagggagagtc |
28476803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 36 - 238
Target Start/End: Original strand, 51957651 - 51957850
Alignment:
| Q |
36 |
gagaccaacattgctgctggtgcagtttctgttagctcagctgcagtcgaattagccttgatgaagttacctgatcaagcctcacatggaaatgcaagaa |
135 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| || ||||| || || || || |||| |||||| ||||||| ||||||||||| ||||| || | |
|
|
| T |
51957651 |
gagactaatattgctgctggggcagtttctgtgagttcagccgctgtggagttggcctatatgaagctacctga---agcctcacatgataatgccagga |
51957747 |
T |
|
| Q |
136 |
tgcttgttattggagctggtaaaatggggaagcttgtgatcaaacatttggttgcaaaagggtgtaaaaagatggtagttgttaatagaaccgaagggag |
235 |
Q |
| |
|
|||| |||| || ||||| || ||||| ||||| |||||||||||||||||| | ||||| || | || |||||| ||||| ||||| ||||| | ||| |
|
|
| T |
51957748 |
tgctgattatcggtgctgggaagatgggaaagctggtgatcaaacatttggtttcgaaaggttgcacaaggatggttgttgtcaataggaccgaggagag |
51957847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 225
Target Start/End: Original strand, 36828658 - 36828724
Alignment:
| Q |
159 |
atggggaagcttgtgatcaaacatttggttgcaaaagggtgtaaaaagatggtagttgttaatagaa |
225 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
36828658 |
atggggaagctagtgattaaacatttggttgctaaagggtgtcgaaaaatggttgttgttaatagaa |
36828724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University