View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19548_low_14 (Length: 250)
Name: NF19548_low_14
Description: NF19548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19548_low_14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 28476583 - 28476821
Alignment:
| Q |
12 |
atgaacctacgtttctcggaacagaaatatctacgaagaggcgttttcctcccatttcttcgcttgctaaaggaagttccttaacattttgtttcaaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28476583 |
atgaacctacgtttctcggaacagaaatatctacgaagaggcgttttcctcccatttcttcgcttgctaaaggaagttccttaacattttgtttaaaaat |
28476682 |
T |
|
| Q |
112 |
caaaggattctctgatgcagtgctagtgaaaacaacatctgcttcaccaatacattcgagcatttccgaaagcggtttgtagattatctcaacatcattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28476683 |
caaaggattctctgatgcagtgctagtgaaaacaacatctgcttcaccaatacattcaagcatttccgaaagcggtttgtagattatctcaacatcattt |
28476782 |
T |
|
| Q |
212 |
atttcttcacggattgctgcgactctcccttcggttcta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28476783 |
atttcttcacggattgctgcgactctcccttcggttcta |
28476821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 51957961 - 51957845
Alignment:
| Q |
122 |
tctgatgcagtgctagtgaaaacaacatctgcttcaccaatacattcgagcatttccgaaagcggtttgtagattatctcaacatcatttatttcttcac |
221 |
Q |
| |
|
|||||||| || || ||||| || ||||||||||||| || ||| ||||||||| ||||| |||||||| ||||| |||| ||| || | |||||| | |
|
|
| T |
51957961 |
tctgatgctgtactggtgaatactacatctgcttcacaaacacaagagagcatttctgaaagaggtttgtaaattatttcaatatccttcagttcttcgc |
51957862 |
T |
|
| Q |
222 |
ggattgctgcgactctc |
238 |
Q |
| |
|
| ||||| || |||||| |
|
|
| T |
51957861 |
gtattgcagcaactctc |
51957845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University