View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19549_high_16 (Length: 236)

Name: NF19549_high_16
Description: NF19549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19549_high_16
NF19549_high_16
[»] chr5 (2 HSPs)
chr5 (85-165)||(42438752-42438833)
chr5 (37-69)||(42567217-42567249)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 85 - 165
Target Start/End: Complemental strand, 42438833 - 42438752
Alignment:
85 ggaggttttggctctaacggcggcattgacggcgtcttcgagcttacgggaaagcatgta-taatcaaggtattcttgaacg 165  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||| ||||||||||||    
42438833 ggaggttttggctctaacggcggcattgacggcgtcttcgagtttacgggaaagcatgtatttatcaagatattcttgaacg 42438752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 69
Target Start/End: Original strand, 42567217 - 42567249
Alignment:
37 aactcaaaactataataaactctgcattgagaa 69  Q
    ||||||||||||||||||||| |||||||||||    
42567217 aactcaaaactataataaactatgcattgagaa 42567249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University