View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19549_high_16 (Length: 236)
Name: NF19549_high_16
Description: NF19549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19549_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 85 - 165
Target Start/End: Complemental strand, 42438833 - 42438752
Alignment:
| Q |
85 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagcttacgggaaagcatgta-taatcaaggtattcttgaacg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
42438833 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagtttacgggaaagcatgtatttatcaagatattcttgaacg |
42438752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 69
Target Start/End: Original strand, 42567217 - 42567249
Alignment:
| Q |
37 |
aactcaaaactataataaactctgcattgagaa |
69 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
42567217 |
aactcaaaactataataaactatgcattgagaa |
42567249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University