View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19549_high_18 (Length: 222)
Name: NF19549_high_18
Description: NF19549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19549_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 206
Target Start/End: Complemental strand, 40215690 - 40215493
Alignment:
| Q |
12 |
gaagaatatgtttaaccatgcagagaattactctagcacactgagagccactagcttcaaaaagattgacaatgtcatctttggtcttactttcctgtt- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40215690 |
gaagaatatgtttaaccatgcagagaattactctagcacactgagagccactagcttcaaaaagattgacaatgtcatctttggtcttactttcctgtta |
40215591 |
T |
 |
| Q |
111 |
-nnnnnnntgtagcatatcaattacttcaattcaatttcatgtatatacaaacaagtgg-agaaagtaaacaatacttttctaagatcaccgcaaaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40215590 |
aaaaaaaatgtagcatatcaattacttcaattcaaattcatgtatatacaaacaagtggaagaaagtaaacaatacttttctaagatcactgcaaaag |
40215493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University