View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19549_high_19 (Length: 214)
Name: NF19549_high_19
Description: NF19549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19549_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 26037994 - 26037790
Alignment:
| Q |
1 |
aaaaggagcatgattcaagtgggataaatcataaaagcaaaagcttaattaatttatctttttgatcatttatcgttttagaatggtctcccatcttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26037994 |
aaaaggagcatgattcaagtgggataaatcataaaagcaaaagcttaattaatttatctttttgatcatttatcgttttagaatggtctcccatcttaga |
26037895 |
T |
 |
| Q |
101 |
tatggttagaaaatatga-------annnnnnnnnaattaacctcgtaattgttcatgtgatttgacaaaattttacattaattatcaagtctgatagaa |
193 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26037894 |
tatgtttagaaaatatgattctttttttttttgttaattaacctcgtaattgttcatgtgatttgacaaaattttacattaattatcaagtatgatagaa |
26037795 |
T |
 |
| Q |
194 |
atttt |
198 |
Q |
| |
|
||||| |
|
|
| T |
26037794 |
atttt |
26037790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University