View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19549_low_17 (Length: 230)
Name: NF19549_low_17
Description: NF19549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19549_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 73 - 151
Target Start/End: Original strand, 8343882 - 8343960
Alignment:
| Q |
73 |
gactcaatccggaaacccccttatccgtaaagttagtaaattattaaattaaagattgaatgaatagggacaatgtttc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8343882 |
gactcaatccggaaacccccttatccgtaaagttagtaaattattaaattaaagattgaatgaacagggacaatgtttc |
8343960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University