View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1954_low_1 (Length: 355)
Name: NF1954_low_1
Description: NF1954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1954_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 32923296 - 32923511
Alignment:
| Q |
18 |
aaggatgcctcatattggattaagatccaatatgtaaatggtctcacaattgatggcacacgcagaggaagaattaacggccatggttctacttggtggc |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32923296 |
aaggatgcctcatattggatta-gatccaatatgtaaatggtctcacaattgatggcacacgcagaggaagaattaacggccatggttctacttggtggc |
32923394 |
T |
|
| Q |
118 |
aatgcaaaagttgccctagacctagagtatgattattctacatgttgtgctacaaatacattttaaaattaaaaaattttaattgaagtatattgtagtc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
32923395 |
aatgcaaaagttgccctagacctagagtatgattattctacatgttgtgctacaaatacattttacaactaagaaattttaattgaagtatattgtagtc |
32923494 |
T |
|
| Q |
218 |
aatcaagagatttgctg |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32923495 |
aatcaagagatttgctg |
32923511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 31 - 174
Target Start/End: Complemental strand, 11659218 - 11659075
Alignment:
| Q |
31 |
attggattaagatccaatatgtaaatggtctcacaattgatggcacacgcagaggaagaattaacggccatggttctacttggtggcaatgcaaaagttg |
130 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||| || ||||| |||| ||||| |||||||||| ||||||| |||||| ||||| |
|
|
| T |
11659218 |
attggattaagatccaatatgtaaacggtgtcacaattgatggcacaggcggaggaggaatcgacggcaatggttctacatggtggccatgcaagagttg |
11659119 |
T |
|
| Q |
131 |
ccctagacctagagtatgattattctacatgttgtgctacaaat |
174 |
Q |
| |
|
| || ||||||| ||||||||||||| ||| |||||||| |||| |
|
|
| T |
11659118 |
ctctcgacctagggtatgattattctgcatcttgtgctaaaaat |
11659075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 32 - 159
Target Start/End: Original strand, 2523906 - 2524029
Alignment:
| Q |
32 |
ttggattaagatccaatatgtaaatggtctcacaattgatggcacacgcagaggaagaattaacggccatggttctacttggtggcaatgcaaaagttgc |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |||||||||| |||||| ||||| ||||||| |
|
|
| T |
2523906 |
ttggattaggatccaatatgtaaatggtctcacaattgatggcaca---ggaggaggaattgacggctatggttctacatggtggtcatgcataagttgc |
2524002 |
T |
|
| Q |
132 |
cctagacctagagtatgattattctaca |
159 |
Q |
| |
|
| | |||||| ||||||| ||||||||| |
|
|
| T |
2524003 |
cttcgacctatagtatga-tattctaca |
2524029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 331
Target Start/End: Original strand, 32923577 - 32923609
Alignment:
| Q |
299 |
gaattcaattaaaatgaaaacctgctttgagta |
331 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
32923577 |
gaattcaattaaaatgacaacctgctttgagta |
32923609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University