View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_high_4 (Length: 509)
Name: NF19550_high_4
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 9 - 478
Target Start/End: Complemental strand, 4392517 - 4392054
Alignment:
| Q |
9 |
gagaagcaaagggaacaaggaaaagaatacatgctggggacttaattaggaatcttgttggtgcagagatggcagagnnnnnnnnggtgttaatgctagg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4392517 |
gagaagcaaagggaacaaggaaaagaatacatgctggggacttaattaggaatcttgttggtgcagagatggcagagaaaaaaaaggtgttaatgctagg |
4392418 |
T |
 |
| Q |
109 |
gctttcatcacttagaaagaaagnnnnnnnnnnnggtgtggagtgtttgtgatctgaacaatttgtctctttcttttaacacatttccatgggggaaggg |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4392417 |
gctttcatcacttagaaagaaa------aaaaaaggtgtggagtgtgtgtgatctgaacaatttgtctctttcttttaacacatttccatgggggaaggg |
4392324 |
T |
 |
| Q |
209 |
aaagagaaaaagaaagagtagtgagttgtgtgttattaatgagattgtgtagaaataataagtgtgggattattctaatggatgaggttgttgtatggga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4392323 |
aaagagaaaaagaaagagtagtgagttgtgtgttattaatgagattgtgtagaaataataagtgtgggattattctaatggatgaggttgttgtatggga |
4392224 |
T |
 |
| Q |
309 |
ataaataggggttgaggggatggaggattttcaaactttcaaagtcaagaatattgggttgggtgtgtactagtttttgattggaaaacggtggtgggtt |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4392223 |
ataaataggggttgaggggatggaggattttcaaactttcaaagtcaagaatattgggttgggtgtgtactagtttttgattggaaaacggtggtgggtt |
4392124 |
T |
 |
| Q |
409 |
agtaattgcaagtattttgggtcattttgggcaaagtaaggactaaggtttttggattgaatcgagggag |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4392123 |
agtaattgcaagtattttgggtcattttgggcaaagtaaggacttaggtttttggattgaatcgagggag |
4392054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University