View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_low_15 (Length: 369)
Name: NF19550_low_15
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 13 - 353
Target Start/End: Complemental strand, 38223907 - 38223567
Alignment:
| Q |
13 |
ttctgcggtgggaaaatctagcaaaggaaacggaacagttaggaaagagcagttggtgtagattgattatggaggagatgacagtatctttggcagctcc |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223907 |
ttctgcgatgggaaaatctagcaaaggaaacggaacagttaggaaagagcagttggtgtagattgattatggaggagatgacagtatctttggcagctcc |
38223808 |
T |
 |
| Q |
113 |
tgctttagcatcacaatcattcatgaacaatcaaacgcctgcagtccttgtagctagtgcgttgctgaaactgcataaaatcccccagtggatgagatct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223807 |
tgctttagcatcacaatcattcatgaacaatcaaacgcctgcagtccttgtagctagtgcgttgctgaaactgcataaaatcccccagtggatgagatct |
38223708 |
T |
 |
| Q |
213 |
gtgtttaacaattcatgcatatctggcatactggagaaccttgctgctaataatttgagcccggaaattttggttttatttcgagaactactgaaatctg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223707 |
gtgtttaacaattcatgcatatctggcatactggagaaccttgctgctaataatttgagcccggaaattttggttttatttcgagaactactgaaatctg |
38223608 |
T |
 |
| Q |
313 |
acttcttaagtactgagcaaattgcaactataagtcaaatg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223607 |
acttcttaagtactgagcaaattgcaactataagtcaaatg |
38223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University