View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_low_17 (Length: 364)
Name: NF19550_low_17
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 40 - 348
Target Start/End: Complemental strand, 27776671 - 27776360
Alignment:
| Q |
40 |
aaatggaactggattagattgaggaaaatcaacttcatataatccatgagccgctctagctttgccaatcatcttc---gtattcatttcctttacaaga |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27776671 |
aaatggaactggattagattgaggaaaatcaacttcatataatccatgagccgctctagctttgccaatcatcttcaaggtattcatttcctttacaaga |
27776572 |
T |
 |
| Q |
137 |
caatgatcatcataaaaggaaacaaaacatggtgactgattagtaagcttaataactgaaataaggttgaaagaaaaatgaggaacatatataacatcaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27776571 |
caatgatcatcataaaaggaaacaaaacatggtgactgattagtaagcttaataactgaaataaggttgaaagaaaaatgaggaacatatataacatcaa |
27776472 |
T |
 |
| Q |
237 |
ataaagtaatagtctttgtgaggtgcatggtgccccaaatactagttatgtcttgttggccattgggaaggtttatgggaatgggtttaaagaggcgcac |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27776471 |
ataaagtaatagtctttgtgaggtgcatggtgccccaaatactagttatgtcttgttggccattgggaaggtttatgggaatgggtttaaagaggcacat |
27776372 |
T |
 |
| Q |
337 |
aacacagaagta |
348 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
27776371 |
aacacacaagta |
27776360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University