View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_low_29 (Length: 238)
Name: NF19550_low_29
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 38439300 - 38439509
Alignment:
| Q |
18 |
atatttagacactatcaaactaaacacatgtgaccactcgattttagcttgggtatcgttgatcattcaatatgaacaatacaatgttttcactcactaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38439300 |
atatttagacactatcaaactaaacacatgtgaccactcgattttagcttgggtatcgttgatcattcaatatgaacaatacaatgttttcactcactaa |
38439399 |
T |
|
| Q |
118 |
ttaacatctttgtcttttttgttactctgacttgccactatgtatgcaattagaataagctcaaccatgtttccaaccgagttcctgctatgtacatttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38439400 |
ttaacatctttgtcttttttgttactctgacttgccactatgtatgtaattagaataagctcaaccatgtttcgaaccgagttcctgctatgtacatttt |
38439499 |
T |
|
| Q |
218 |
gcatgatgat |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
38439500 |
gcatgatgat |
38439509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University