View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_low_30 (Length: 238)
Name: NF19550_low_30
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 229
Target Start/End: Complemental strand, 41296737 - 41296638
Alignment:
| Q |
130 |
cgtgtgagttttaaaatgactcgcttggtgtcggaggtatatgcatcaatggagtggggtgacgtatgccaaccacttcggtgcttgccacaggttctgc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
41296737 |
cgtgtgagttttaaaatgactcgcttggtgtcggaggtatatgcatcaatggagtggggtgacgtatgccaactacttcggtgcttgccacgtgttctgc |
41296638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 41296843 - 41296791
Alignment:
| Q |
24 |
agaggttgaatcggaggaagggtttggcggcgaagggagttaccggtcgccgg |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41296843 |
agaggttgaatcggaggaagggtttggcggcgaagggagctaccggtcgccgg |
41296791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University