View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19550_low_32 (Length: 219)
Name: NF19550_low_32
Description: NF19550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19550_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 54 - 206
Target Start/End: Complemental strand, 20065177 - 20065025
Alignment:
| Q |
54 |
aaatgatacagaacttcaaaaccgtgcattacttgtaatatttgagacggttgactttaagaagaatgtctcaaatctttatgaagaagaaggagtgact |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20065177 |
aaatgatacagaacttcaaaaccgtgcattacttgtaatttttgagacggttgactttaagaagaatgtttcaaatctttatgaagaagaaggagtgact |
20065078 |
T |
 |
| Q |
154 |
ctaaaggcataatagtgtaactcttcatcatatagtactcatcttactgatga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20065077 |
ctaaaggcataatagtgtaactcttcatcttatagtactcatcttactgatga |
20065025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 67 - 137
Target Start/End: Original strand, 20301245 - 20301315
Alignment:
| Q |
67 |
cttcaaaaccgtgcattacttgtaatatttgagacggttgactttaagaagaatgtctcaaatctttatga |
137 |
Q |
| |
|
||||| |||| |||||||||||| || |||||||| |||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
20301245 |
cttcagaaccatgcattacttgtgatttttgagaccattgactttaaaaagaaagtctcgaatctttatga |
20301315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University